notes on summer ghazals

June 30, 2014 § 2 Comments

1. resist the urge to write couplets that connect one to the other

2. but total randomness doesn’t work either

3. give in to the urge to write couplets that connect one to the other

4. or at least, give in to the semiotic — rhythm, rhyme, recurring patterns of sound

5. someone told me yesterday there’s a boy in a cave in Spain, writing poetry

6. each couplet is a pair of nucleic acids, GC, AT: one completes the other

7. secular desire is encoded as sacred, and vice versa

8. once you begin, it is difficult to stop (bastard ghazal, north american ghazal, not really a ghazal, ghost). it is a serious addiction

9. anything might enter a ghazal, like the tiny wasp with copper wings that has landed on my knee, or everyone who comes to this park to smoke pot except me

10. this list has elements of a ghazal. this is not a ghazal

Advertisements

poems and other domestic objects

April 6, 2013 § Leave a comment

“It is worth one’s while, at certain hours of the day or night, to scrutinize useful objects in repose: wheels that have rolled across long dusty distances with their enormous loads of crops or ore, charcoal sacks, barrels, baskets, the hafts and handles of carpenter’s tools. The contact these objects have had with man and earth may serve as a valuable lesson to a tortured lyric poet. Worn surfaces, the wear inflicted by human hands, the sometimes tragic, always pathetic, emanations from these objects give reality a magnetism that should not be scorned.

Man’s nebulous impurity can be perceived in them: the affinity for groups, the use and obsolescence of materials, the mark of a hand or a foot, the constancy of the human presence that permeates every surface.”

–from “Some Thoughts on Impure Poetry,” quoted in the Introduction to Residence on Earth xii-xiii

Neruda, who wrote odes on socks, a table, a chair, here describes the marks of labour carried by objects. In an earlier post (“the poem as artefact that carries traces of its own making”) I’ve considered, with reference to Elaine Scarry’s extension of Marx in The Body in Pain, the traces of making that objects carry — the cloth which is “soaked” in labour, which carries traces of sweat, blood, the pin pricks and marks, the very weave of the cloth — and the subsequent alienation of the maker from such labour.

The objects Neruda describes here seem to come largely from the stereotypically masculine realm of labour: carpenter’s tools, wheels that bear heavy crops, charcoal sacks. Does he romanticize these common objects, and is there an attempt also to valorize poetry — I mean, to give more every day value to it — by placing it on the same footing as a sack that carries charcoal, or a wheel that bears a heavy load?

Heaney’s poetry also values such tools and the labour of the farm, in his case, the result of his having been raised on a small farm-holding in Northern Ireland. From his earliest collection, with the pen as substitute for the spade (and gun), he invokes the earth. Later collections return often to the trope of the plough and the ploughshare (again, with reference to the boustrophedon and versus, to the modern line’s turn at the end of each verse, and to the lovely image of the poem which turns back time):

My father’s ploughing one, two, three, four sides
Of the lea ground where I sit all-seeing
At centre field, my back to the thorn tree
They never cut. The horses are all hoof
And burnished flank, I am all foreknowledge.
Of the poem as a ploughshare that turns time
Up and over…

–‘Poet’s Chair,’ in The Spirit Level

The many domestic objects which work their way into his poetry are not limited to the masculine realm. There’s the turnip-snedder in District and Circle: in an age of “bare hands/and cast iron,//the clamp-on meat-mincer,/the double flywheeled water-pump,//it dug its heels in among wooden tubs/and troughs of slops…” There’s also the beautiful dedicatory poems to North, in particular “Sunlight,” dedicated to his aunt Mary:

There was a sunlit absence.
The helmeted pump in the yard
heated its iron,
water honeyed

in the slung bucket
and the sun stood
like a griddle cooling
against the wall…

He goes on to describe her floured hands and apron as she makes scones, the “plaque of heat” given off by the stove, dusting the board with a goose’s wing. Then comes the quiet moment as she has time to rest between work:

here is a space
again, the scone rising
to the tick of two clocks.

And here is love
like a tinsmith’s scoop
sunk past its gleam
in the meal-bin.

Time is love and food, and the preparing of it, and plenitude — love as a scoop that is “sunk past its gleam.” North quickly descends into the darkness of myth, but still finds its ground in the archaeological objects of a distant Viking and Iron Age past. In this description of baking in the dedicatory poem, there is still the fairly strict demarcation of male and female roles, as there also tends to be when Heaney lays out his various schemata of English/Irish roots in his theoretical explorations of his own poetry: masculine, consonantal, air, clarity and light, the long line of iambic pentameter, all contrasted with feminine, vowelled, earth, darkness, the short, cutting line of North.

I turn often to Eavan Boland to read poetry with domestic objects and experiences from a woman’s perspective: fabric, cloth, the kitchen, children, illness, the confined spaces of small rooms in the suburbs. Boland is particularly fine in her poems that incorporate cloth. For example, in The Journey when she describes her search for a language like lace, or in “The Unlived Life,” her description of quilting in the new world:

to formalize the terrors of routine
in the algebras of a marriage quilt
on alternate mornings when you knew
that all you owned was what you shared.

Cloth in its long history is the history of women.  Elizabeth Wayland Barber traces this labour in Women’s Work: The First 20,000 Years: Women, Cloth, and Society in Early Times, and in The Mummies of Ürümchi, where she describes the woven textiles of the Beauty of Loulan and other mummies found on the edge of the Taklamakan desert, along the old Silk Road. Cloth, like DNA, carries signatures, traces of its history, of how and when it was made, of where it comes from. Cloth is analogue for language and for skin, which comes into close contact with another.

In The Material of Poetry, Gerald Bruns, citing Levinas, describes poetry as object, as ethical contact with the world, language as skin. The aural qualities of a poem operate on a different level from the visual which emphasizes objectification, sudden complete comprehension, totality, versus the unfolding of sound over time, which is partial, incremental, and intimate as touch (as radio is more intimate than television). Poetry requires listening, which

“involves a form of subjectivity — indeed a kind of experience — different from seeing; it implies or entails a porous, as against a self-contained, mode of being, and it also implies a different world from the one that seeing, perception, observation or conceptualization constructs or projects onto the screen of consciousness. In an essay on ‘The Transcendence of Words,’ Levinas says, ‘To see is to be in a world that is entirely here and self-sufficient.’ Sound, however, undoes this state of self-sufficiency and contentment — and it is important to know that Levinas is thinking of the sounds of words rather than, say musicalized or harmonized sounds. Specifically, he is thinking of voiced sounds in which sound is no longer a semantic medium or the embodiment of aesthetic form but rather a mode of sensibility irreducible to vision, comprehension, or containment within categories.” p.44

Bruns is referring here to the role of sound in poetry over and above its semantic content; we’re within earshot perhaps of Kristeva’s distinction between genotext and phenotext. He notes also how sound overwhelms the firm borders of the self; “sound bleeds the self.” p.45. Listening to a poem is to exist in the “mode of being touched.” p.43 The poet’s relationship to language is one of listening. [1]

Similarly, Robert Pinsky, in Democracy, Culture, and the Voice of Poetry, speaking of the Favourite Poem Project, describes the reading of a poem as being inhabited by it, of giving oneself up to this mode of being touched. In fact, the reader becomes “an actual, living medium for the poem.” p.61 This is Jane Hirshfield again, on taking the poet’s breath into your body, to give life to his or her words once more. There is a cohabitation in this, a living with another for the time it takes to speak the poem, a willingness to become the medium for that person’s voice.

But I have gone somewhat astray — or perhaps not. The experience of a poem, as in the wearing of cloth, or in the pleasure of touch, is one of proximity. I was describing cloth as analogue of poem and skin. In Boland’s poetry cloth is intimate with the human body, linked to both labour and desire, and its accompanying dangers:

Tonight in rooms where skirts appear steeped in tea
when they are only deep in shadow and where heat
collects at the waist, the wrist, is wet at the base of the neck,
the secrets of the dark will be the truths of the body
a young girl feels and hides even from herself….

(2. How the Dance Came to the City in Domestic Violence)

Boland describes many other kinds of domestic objects in her poetry. Here she is writing about antibiotics, from the title poem of The Journey:

And then the dark fell and ‘there has never’
I said ‘been a poem to an antibiotic:
never a word to compare with the odes on
the flower of the raw sloe for fever

Depend on it, somewhere a poet is wasting
his sweet uncluttered metres on the obvious

emblem instead of the real thing.

Perhaps I am stretching things by thinking of an antibiotic as artefact or domestic object, but I take my lead from Scarry and her wide-ranging account of the role of human artefacts, including language, in making the world. This brings me back to Neruda again, and his insistence on an impure poetry, an insistence on poem as labouring object, and Scarry’s description of a poem as being able to work on the world in a positive sense, to rework it, and change ourselves as a result.  I’m thinking of the use of a poem in a very diffuse way as this ability to work upon the world by working upon — by touching — another’s consciousness, and transforming it.


[1] I’m less convinced by Bruns’ defence of sound poetry as joyous vociferation; what he describes as an opening of the self to sound (and he describes exclusively male projects and projections here) feels more like unwelcome, one-way invasion, of being forced open.

note on Oulipo constraints & DNA poetry (a genomic poem)

January 30, 2013 § Leave a comment

Inevitably, DNA provides an interesting model for a poem generated by means of Oulipo-esque constraints. If we think of language as arbitrary system by which the poet is written, we might model this with a series of somewhat arbitrary constraints inspired by codon-into-amino acid production; the byproduct of the writing process might look something like a chromosome in the sequenced genome of a small organism. Guillardia theta, for example, a eukaryotic nucleomorph genome, sequenced in 2001.

The four DNA acids, C G A T, in various combinations of 3, in turn produce X number of amino acids—21 in the human body—which express the organism. A DNA codon chart might be created to generate a genomic poem.

See  Christian Bök’s fascinating Xenotext Experiment; which takes the idea of poetry as DNA literally in the form of a “poetry bug,” a poem that might “‘infect’ the language of genetics.” His discussion of contagion, infection, and language as virus with reference to this project is also reminiscent of Renaissance conceptions of human interaction with the world (melancholy, love, the plague, almost anything could be contracted through the air, the eye, the ear…) now translated into our 21st century genetic paradigms, and more general interest in things ‘viral.’

I’m more interested in DNA as extended conceit or metaphor for poetry, and tracing this genealogy back to organic models for poetry and poetic production in the Romantics (Coleridge and the idea of an ‘organic’ versus mechanical poetic process; Keats’ description of poetry coming as leaves to a tree.)

But to return to the idea of a DNA codon table to generate a genomic poem: this would make an interesting book of poetry in theory: the codon table as frontispiece, followed by however many pages of the sequenced organism/poem.

the DNA of Shakespeare’s Sonnets

January 25, 2013 § Leave a comment

“TAGATGTGTACAGACTACGC…..”   (Thou art more lovely and more temperate...)

An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.

I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.”  Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.

So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.

This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).

Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.

Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.

The earliest forms of poetry also carried practical information—poems do things:  Hesiod’s Works and Days;  perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.

And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.

The Guardian article explains how the encoding takes place:

“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.

To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”

This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.

Then the DNA is stored in a dry, cool, dark place.

A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.

But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate.  Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…”  Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved  in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.

In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.

Where Am I?

You are currently browsing entries tagged with DNA at kim trainor's blog.