Karyotype, first copies!

September 11, 2015 § Leave a comment

IMG_2047

Advertisements

the DNA of Shakespeare’s Sonnets

January 25, 2013 § Leave a comment

“TAGATGTGTACAGACTACGC…..”   (Thou art more lovely and more temperate...)

An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.

I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.”  Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.

So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.

This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).

Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.

Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.

The earliest forms of poetry also carried practical information—poems do things:  Hesiod’s Works and Days;  perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.

And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.

The Guardian article explains how the encoding takes place:

“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.

To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”

This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.

Then the DNA is stored in a dry, cool, dark place.

A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.

But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate.  Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…”  Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved  in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.

In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.

the poem as artefact that bears traces of its own making

January 24, 2013 § 4 Comments

It is also possible to think of a poem as a material artefact, whether constructed out of sound, or the letters of the alphabet, which function as a fossilized notation of sound. Jane Hirshfield’s observation on the experience of speaking or reading a poem is again useful:

“Saying a poem aloud, or reading it silently if we do so with our full attention, our bodies as well as our minds enter the rhythms present at that poem’s conception. We breathe as the author breathed, we move our own tongue and teeth and throat in the ways they moved in the poem’s first making. There is a startling intimacy to this. Some echo of a writer’s physical experience comes into us when we read her poem.” [1]

She reminds us that words have a physical origin, anchored in the body of the poet. Nor is it incompatible to think of a poem as both material artefact and living flesh; the poem as material artefact is a projection of the human being (the human body) into the world—a projection of sentience, moral perception, emotion, idea—in a form which can now be shared with others, and which can last through time, working on the world as other tools of our material culture do—which then, as Marx and Scarry note, rework our own sentience, our own selves.

Hirshfield also reminds us of this material nature of the poem—the poem as artefact—when she observes how the effect of time alters our perception of it. Strangeness in the language of a poem as it ages through time functions as a kind of patina for future readers, a historical ‘signature’:

“When an original grows old, its dated words and syntax serve as a kind of watermark. Age in itself gives substance—what has lasted becomes a thing worth keeping. An older poem’s increasing strangeness of language is part of its beauty, in the same way that the cracks and darkening of an old painting become part of its luminosity in the viewer’s mind: they enter not only the physical painting, but our vision of it as well.” [2]

To describe a poem as we might a painting helps us to remember that, however ephemeral or immaterial a poem may seem, it is still a physical thing that can work on the world as much as a telescope or a microscope, tools which help to extend our range of sight. As an object which can hold and share a human’s perceptions and sensations with others, even those who live far in the future, the poem might be described as analogous to a container or vessel—it carries some essence or knowledge of the poet, knowledge which was once restricted to the borders of the poet’s body, but can now be shared.[3]

Another analogy I have suggested is that of a woven cloth, composed of many disparate threads. I am sympathetic to this comparison because of the work I did with “Karyotype.” Some of the poems in the sequence describe the cloth worn by the people of the Tarim Basin, and use the language of woven cloth—warp, weft, plain weave, selvedge—a vocabulary which reminds us of the complex work of weaving, a skill that was once essential to know in order to provide clothing, blankets, and other household textiles for your family, but is now almost a forgotten skill due to the industrialization of the process. As Elizabeth Wayland Barber points out, we are hardly even aware of the fact that most of our clothing is still made from woven cloth, and that the ancient patterns can still be seen in the plain weave of our cotton shirts, the twill of our jeans.

The poem-as-woven-cloth analogy also reminds us of the work and care that goes into making a poem. It reminds us that a poem bears the marks of the labour that went into its making. Just as a piece of cloth can be read for clues as to how it was made (the width of cloth produced by a portable loom; the kind of selvedges; patterns such as twill or plaid or plain weave; the smooth or rough transition from one colour or pattern to the next), so does a poem (the metre as the warp across which the rhythm is weft; choice of line endings in tension with syntax; formal and aural repetitions; transitions from one stanza to the next, from octave to sestet, and so on); these clues also tell us something of the skill of the maker.

I find it very difficult, excruciating, in truth, to look at my poems for this reason—I see the awkward transitions, the slips, the failures of technique, raw places where I could have done better. A poem is never finished; there is always more work to do.

Take for example ‘Karyotype XVI’:

XVI

Running the length of the skinny
little body, the narrow cloth
is wrapped, the tan warp tucked across

her like the threads of a cocoon,
as she is waiting to emerge
from her long sleep. Moon-

face in her pod of softest brown
stitched closed with carved bone pins,
the mottled wasp-nest skull

and tapered form
so carefully framed with selvedges
and checks, as if a young woman

made this as she learned to weave,
a sampler gangly as the child
she had to wrap so carefully and leave

in the cold ground, her child.

[This poem first appeared in Event Magazine;
my thanks to the editors.
]

I find it almost unbearable to read for the technical errors I see shot through it. I worry about the line breaks in the first stanza, and the way the sentence breaks across the first stanza into the second. Why end the first line on “skinny”? Why end the third line on “tucked across” and place “her” at the beginning of the fourth line? It could easily go at the end of the third line as a downbeat, an extra syllable resulting in a feminine ending, still iambic in sound. I suppose it could be argued the break between the first and second stanzas enacts the warp stretched across a space from life to death, to accommodate the body.

The rhyme throughout is very slant (I was simply aiming for two lines in each stanza to rhyme, at least in part): cloth/across, brown/pins, form/women. And as Mary Kinzie has noted in Poet’s Guide to Poetry, end rhymes are harder to hear if the lines don’t end on the phrase or clause or the close of a sentence, as with enjambed lines the ear is already skipping ahead to the next line to complete the syntactical construction. I’m not sure if I like the repetition of the phrase “so carefully,” one to refer to the work done on the sampler/shroud, the second to the wrapping of the child’s body in this piece of cloth. The lines don’t scan very smoothly—they are also awkward, although it improves a little towards the end.

There are elements I like as well: the way the penultimate line breaks off at “leave,”—again, the unbearable space between life and death—and the final line resumes after crossing this space, “in the cold ground, her child,” so that “the child” is separated from the mother, as the line orphans her. I like that I attempted to describe the child and her shroud accurately: tan warp, stitched closed with carved bone pins, the mottled wasp-nest skull; the language of weaving and making is merged with natural forms made by insects (cocoon, wasp-nest). So despite the technical errors, I still feel protective towards this ungainly poem, as if it enacts the woven sampler with its awkward transitions that show the inexperience of the maker. The poem seems to me now unwittingly like the cloth sampler it tries to describe.

‘Karyotype XVI’ is based on a photograph and description of the Qäwrighul child in Elizabeth Wayland Barber’s Mummies of Ürümchi. The photograph shows a child of about eight years old who was wrapped in a shroud of cloth which Wayland Barber reads as a ‘sampler’ because of the evidence she sees  in the traces of its making, traces that show the weaver was inexperienced: uneven colour zones, haphazard transitions, “but that is how one learns.” Wayland Barber speculates that perhaps the young woman who wove the cloth eventually used it—perhaps now a piece of scrap cloth—to wrap her child in before placing her in the grave.

I tried to write this poem a second time, outside of the Karyotype sequence. I decided for the second attempt to use blank verse, and to try to describe the sampler in more detail—the oatmeal and tea-coloured patches, Barber’s technical analysis of the work. This time I was more conscious of the comparisons that could be drawn between the inexperienced work of the woven cloth, and the writing of the poem as artefact—as made object that bears traces of its own making.

[1] Jane Hirshfield, Nine Gates: Entering the Mind of Poetry, p.7-8.

[2] Jane Hirshfield, Nine Gates: Entering the Mind of Poetry, p.67.

[3] Ursual K. Leguin explores this analogy as it relates to narrative fiction in her essay, “The Carrier Bag Theory of Fiction.”

on making a chapbook 1

January 24, 2013 § Leave a comment

In June of last year I made a a chapbook of my 23-poem sequence ‘Karyotype,’ about half of which had already been published in little magazines. Although I wanted them to appear in these magazines, the poems also felt fragmented, torn from their original sequence, so I wanted to stitch them back together, as a whole.

To make a chapbook is to take making at its most material—to take paper, thread, glue, boards, cloth, and make a book of poems with your hands. You must think geometrically and spatially: how large should each page be, then double this for a folded signature; for the poems to appear sequentially, in the correct order, which ‘pages’ or ‘leaves’ should be placed on a single sheet? (for example, my Table of Contents and p.26 appeared on the reverse of pages vi and 25—I had to create a diagram to visualize the correct order once folded and interleaved); what of margins and gutters? page numbers? what usually appears on the publication page? the title page?; how many pages can safely be stitched into a signature?; how many milimetres larger must the boards be to cover the signature? how wide the strip of book cloth?; should I cut the papers with scissors or tear them with a ruler to create a softer edge? And so on. I used my copy of A.E. Housman’s A Shropshire Lad, published by the Richards Press in 1947, as the physical model for my own book because I liked its dimensions—12cm by 19cm, as well as the roughly cut papers and its feel in my hands.

Making a book of poems in this way takes time and care; it is a physical activity. I worked at the kitchen table where I could spread out all of the necessary tools: X-acto knife, cork-lined ruler, plastic ruler, pencil, sandpaper, white glue, paint brushes, a yoghurt lid to hold the glue, a wallpaper spreader to burnish the boards, needle, linen thread, awl. The cutting of the boards alone took one afternoon. Because I have no desktop publishing program, I had to lay out and glue a template by hand; this took another day.

Yet it is also fairly simply to make a book. Photocopy as many copies as you need of your template. Fold the printed sheets and place them in the correct order. Fold the end papers and add them to the outside of the signature. Mark the central spine where the stitches will go. Use the awl to punch needle holes. A simple saddle stitch to tie the pages together with thread—complicated to explain in words, but easy to see and to imitate; it is something your hands must learn to do. For the cover, glue the boards onto the narrow strip of book cloth, glue the paper covers onto the boards—tuck and fold around the edges. Glue the outer end papers of the signature onto the boards. Press overnight under a stack of heavy books.

Each morning I could make no more than five chapbooks—this took me about four hours. Then I became too frustrated, and my fingers became too sore. I began to make mistakes. My time improved a little as I figured out certain things. For example, I realised that I should treat the cover paper, once the glue went on, as if it were wet cloth which could be lifted and repositioned, the wrinkles smoothed out and folded over with my finger tips. I learned to put just the right amount of glue on, so that when I burnished the end papers the glue didn’t ooze out onto the cover papers. I learned to close the book once the signature had been glued in and then open it again to work out any wrinkles that accumulated in the end paper near the spine, which acted like a gutter where paper and glue collected.

Some mistakes I couldn’t fix. I’d chosen cover papers that were thin as tissue paper, and then used a laser printer to print the title ‘Karyotype’ in a typewriter font above a line drawing I’d made of the Beauty of Loulan, the iconic focus of the sequence. I realised after making the first ten books or so that the ink was brushing off some of the covers like dust (perhaps because of the random side of the paper they happened to be printed on? a fault in the laser printer? I don’t know). Those covers I had to re-ink by hand. Still, I liked the fragile paper and the faded ink: it was in keeping with the tenor of the sequence, which addresses the ephemerality of human texts—genes, cloth, poems.

It took me a week in total to make all twenty copies: three days to plan the template, to photocopy and cut and fold the signatures; four days to make the covers, stitch and glue in the signatures. That of course doesn’t include the writing of the poems, another kind of making. And it felt very strange, each morning, to take apart the stack of books I used as an impromptu press, and see this small pile of chapbooks accumulate in my hands, as if the sequence now took on a new life, by replication, in this material dimension, distinct from the illegible, handwritten manuscripts, and distinct even from their fragmented appearance in the little magazines. Now ‘Karyotype’ was a physical artefact, my twenty copies existing in and through time, as A Shropshire Lad does, in the 10,000 copies of my 1947 edition.

(Tues. 26 June 2012)

Where Am I?

You are currently browsing entries tagged with karyotype at kim trainor's blog.