Seamus Heaney, 1939 — 2013

August 30, 2013 § Leave a comment

Friday 18 September 2009

I find reading Heaney, then Larkin, that you begin to see the structure of the poet’s mind which is both recognizably human, in that I recognize myself, but at the same time utterly alien and unknowable. Grossman: “A poem is a fiction of a self seen from within.” Summa Lyrica p.246. No, perhaps that isn’t right — not unknowable, because I am in fact able to see or to begin to see this structure of another’s mind, which would, under normal circumstances, be completely inaccessible. Yet still alien, in that this is another mind. With Larkin, I identify and recognize the misanthropic gesture, while with Heaney I yearn for the possibility of transcendence and absolution he describes.

Monday 7 December 2009

What is it that so appeals to me in Heaney’s poems, which I want to emulate in my own? There is an economy of words in his free verse, which gives the appearance of form — 4- or 5-word lines, lines divided into stanzas — tercets or quatrains, although not always…I want to replicate the spareness of Heaney’s earlier poems, combined with his complexity of imagery — startling at times. There is also its groundedness, linked to its subject matter, his childhood on his parents’ farm…I like also the references to writing, letters, school satchels, common objects….His optimism. Their lyrical beauty — this comes through especially in his later collections — The Spirit Level, Seeing Things. They don’t chatter. They sing.

Saturday 2 January 2010

Reading Byatt’s The Children’s Book where there is a lot of discussion of pottery, clays, slips, glazes. I love the word ‘clay.’ …The words draw me — clay, slip, glaze, the metals and elements that produce distinct colours, And I thought of Heaney’s poem in The Spirit Level — ‘To a Dutch Potter in Ireland’: “Grey-blue, dull-shining, scentless, touchable — /Like the earth’s old ointment box, sticky and cool” and “Hosannah in clean sand and Kaolin/And, ‘now that the rye crop waves beside the ruins,’/In ash pits, oxides, shards and chlorophylls.” I like “sticky and cool” — the /k/s, and the word ‘sticky,’ the short and then long vowel, and the idea of clays in the ground that you dabble your fingers in like an ointment box, and of praising clay, the elements. Again it’s the alliteration — ‘clean’ and ‘Kaolin,’ although I don’t know what Kaolin is, the s‘s and sh‘s and then the final /k/ in chlrophylls. And again some kind of progression of vowels — ae, short o, long a, long o — short through long? several kinds of ‘a’? I don’t have the technical vocabulary to precisely describe this yet.

Tuesday 23 February 2010

Rain. It always makes me want to write, to sit quietly with a pen in my hand and a notebook, and work on a poem. I am learning some things about writing poems, about refusing lines that come too easily, holding out for a sharper, more precise or startling image. And about sudden turns in the direction you thought you were going, when the language takes you elsewhere. Reading some of Heaney’s poems — the earlier ones, in North for example — there is a sense of watching an artist at work on a canvas, seeing the technique of laying down words, sounds, a sudden gesture that turns the poem in a new direction, taking you sideways, or turning something inside out, the process of defamiliarization. I’m not describing it right. Throw-away lines, that seem so casual — the last lines of ‘Viking Dublin: Trial Pieces,’ about pampooties. A lightness, and a way of deflecting the too easy (too heavy) conclusion. Or the ending of ‘Bone Dreams,’ although I don’t understand it, about the animal pelt and its tiny eyes. Well, I would like to do that.

Tuesday 6 July 2010

I was reading some of the poems in North while my students wrote their in-class essay last night. Trying to think about the elements that make them distinctively his —

1. place, setting — N. Europe, the bogs, N. Ireland, and also language & dialect as place or location in which you reside;

2. his focus on violence — Iron Age violent deaths, carried in the bodies of the bog people, mapped onto the violence in N. Ireland, if obliquely;

3. A precise, even technical vocabulary, not easily accessible. For example, in ‘Bog Queen,’: turf-face, demesne wall, glass-toothed stone (i.e. granite w/inclusions? glazed with ice?*), braille, Baltic amber, crock, diadem, ‘Carious,’ peat floe, bearings (as in ball bearings), sash, glacier, ‘Phoenician stitchwork,’ ‘retted’ (what is this? “retted on my breasts’/ soft moraines”), fjords, fledge, coomb, stone jambs, skull-ware, tufts. As if looking at a stone wall, all sharp hard words, of one-syllable. No, not entirely — coomb, moraine, floe, fjord, these are all soft. Perhaps I am thinking of the meaning — archaeological or geological terms, applied to a new domaine — the woman’s preserved body. Some descriptions are modified by adjectives that suggest rotting — “slimy birth-cord/of bog,” “bruised  berries.” There are nouns made into unusual verbs, “kinned,” “ossify myself” — from different poems (‘Kinship,’ and ‘Bone Dreams’?); *or, a stone wall topped with shards of glass

4. Brilliant Metaphors — “My body was braille/for the creeping influences” — the body like a tactile text read by the elements. The body as text is not uncommon, nor is land as text to be read — a common colonial gesture. But here it is the land reading her body — this is new, isn’t it? It strikes me as original and startling. Or “they lie gargling/in her sacred heart” — as if a blood rattle, their deaths — from ‘Kinship.’ Or her brain fermenting — “a jar of spawn/fermenting underground”;

5. Spareness, precision. Each line and stanza is pared down, stripped of excess, 7 syllables per line at most, many with less, like imagist poems. There is nothing common, or clichéd, or soft — except in terms of a body which is rotting or bruised. There is economy — a “cured wound” in ‘Grauballe Man;’

6. The erotic — some element of the erotic in these descriptions of her body? Is this because it follows on the heels of ‘Come to the Bower’ and ‘Bone Dreams’? an effect of resonance? from one poem to the next. And there is the erotic married to the violent — nipples like blown amber, always in the description of the woman (Ondaatje does this also) as if describing a rape, that which is taken;

7. Content? What are the poems about? What do they mean? Is this a naive question? And yet they seem deeply significant — at the level of individual words engaging with issues of colonialism and the violence inflicted by language in addition to the historical violence towards which they gesture. e.g. in ‘Bone Dreams’ where he addresses English literary heritage: “I push back/through dictions/Elizabethan canopies,/Norman devices,//the erotic Mayflowers/of Provence/and the ivied Latins/of churchmen/to the scop’s/twang, the iron/flash of consonants/cleaving the line.” As if pushing back through overgrown, flowering plants, he reveals a cross-section of the English language, which his poem cuts through like the flash of consonants where Anglo-Saxon words cleave the line — ban hus, bone house;

8. Abrupt, unexplained transitions — in ‘Bone Dreams,’ the final section on the dead mole? He loses me here. Or is it meant to take us back to the bone he finds in the grass in the opening section? This mole also will decay, and already suggests to him a whole landscape, the “small distant Pennines.”

And then the question becomes, what can I do, what have I done?

Wednesday 15th September 2010

I am reading Human Chain, which came in the mail on Monday, and I saved until late Tuesday night….I’ve only skimmed through it and now want to read it through again, slowly. There are poems on books, and scribes, and writing tools, scraps of Virgil and Keats, echoes of earlier poems he’s written, which is disconcerting — for example, echoes of ‘The Rainstick’ from The Spirit Level in one poem, as if you’re hearing a song transposed into a different key that’s foreign to you ( a different scale?) or a song translated into a foreign language similar to your own. Some repetition of style which has become a verbal tic, like scar tissue. And it also reads like a private summing up of a life — you are welcome to listen in, such an intimate offering, but he doesn’t offer many signposts — you are on your own.

Advertisements

the poem as trace of an event 2

February 28, 2013 § Leave a comment

Five miles away the hayricks and houses
are going up in fire;
beside the fields, peasants smoke their pipes
in silence and in fear.
Here, the lake still ripples at the little
shepherdess’s stride;
on the water a ruffled flock of sheep
stoops to drink a cloud.

Cservenka, 6th Oct. 1944

— “Razglednica (2)”  (Postcard 2), Miklós Radnóti, transl. Francis R. Jones

Beyond local, small-scale ecological witnessing, such as that of Borodale, Oswald, Longley, (discussed in “the poem as trace of an event 1“) some poets become directly caught up in larger historical events, these bloody trajectories of the 20th and 21st centuries, events which are then registered in their poetry in various ways — or sometimes deliberately resisted: Czesław Miłosz, on refusing permission to reprint some of his poems on the Warsaw Uprising: “I do not want to be known as a professional mourner.” (See his interview in The Paris Review.)

What kind of knowledge might a poem carry of an event such as that of the Hungarian poet Miklós Radnóti’s forced march of early November 1944, a march which ended in his execution in a mass grave?

Even during this march Radnóti managed to continue to write small poems in a soft-covered notebook, now known as the “Bor Notebook,” or sometimes “Camp Notebook.” (An online facsimile of it can be found here, from a 2009 exhibit of his work.) This was a small, square-ruled notebook which was later found on his body when the grave where he had been buried was exhumed after the war. [1]

Perhaps the very question is wrong, suggesting a desire for some utility for poetry, a desire that we can trace back in the English tradition at least to Sir Philip Sidney’s Defence of Poesy (published 1595), who argued that poetry should both teach and delight, and which finds expression today in the “ethical turn” in literary studies. David-Antoine Williams offers an informative overview of this ethical turn in chapter 1, “Ethics, Literature, and the Place of Poetry,” of his Defending Poetry: Art and Ethics in Joseph Brodsky, Seamus Heaney, and Geoffrey Hill (2010). Tellingly, he notes that the focus of this ethical turn has been on narrative. Williams observes,

“Many writers on the ethics of literature simply ignore poetry and the poetic altogether: if the neo-Aristotelian didactic and the responsibility-oriented deconstructive streams of ethical criticism share anything, it is that both rely on broad theories of narration, which is to say they regard real or imagined human actions, consequences, and fates (usually) within social situations. It is the narrative components of novels, stories, dramas, etc. that are discussed and debated over, not, usually, their formal effects […] it is unclear where narrative-dependent ethical criticism leaves poetry, especially lyric poetry. Attempts to account for an ethics of poems are often perforce drawn back to narration: Susan Gubar, in discussing recent Holocaust poetry, ultimately locates its ethics in its ability ‘to counter the numbing amnesia inflicted on its casualties by traumatic injury and on their descendants by our collective overexposure to widely circulated narratives of attrocity.’ In other words, poetry’s ethicity depends on the extent to which its narratives can replace or refresh old, worn ones. Unsurprisingly, Gubar’s analysis never lingers on anything non-narrative, formal, or even ‘poetic’ in the poetry she treats.” (p.18)

So when I ask what knowledge a poem such as Radnóti’s “Razglednica (2)”, which I quoted above, might carry, I am thinking of knowledge and an ethical force beyond that which narrative holds. In any lyric poem we find both narrative and lyric elements, where the lyric often bears a heightened focus on language’s own procedures, by means of its formal elements. Williams is pointing here towards these procedures and formal qualities, and how they might be associated with a poem’s “ethicity”.[2]

An initial difficulty in concentrating upon “Razglednica (2)” as a lyric poem is its contextual history. Note that the poem is always published with the place and date of its writing — Cservenka, 6th Oct. 1944; Radnóti was on the forced march by this time. The original notebook includes these details of place and date following each poem, as if a “signature;” all versions of the poems in translation I have read follow him in this. And this signature invites us to always read the ‘postcard’ — ‘razglednica’ is the Serbian word for ‘postcard’ — within the context of his lived history and witnessing, as if each postcard-poem describes an image or snapshot from the march, the ghostly “reverse” of the poem; the notebook itself is often described as a witness from beyond the grave. But does this then relegate his razglednici to mere documentary snapshots of his own slow torture and death? They are often read as transcription or witness of these events, analogous to a newspaper report, as in the final razglednica, where he describes the killing of an acquaintance, which could also be a postcard documenting his own execution several weeks later. Yet what remains then of its status as lyric poem?

“Razglednica (2)” is the second of four such postcard-poems he wrote in the last months of his life. In them Radnóti invokes the pastoral tradition. He was a trained classicist, and some of his work consisted of making translations of Virgil, among others; Radnóti’s finest poems I think are his own “Eclogues,” which incorporate this Virgilian mode of social critique and lament with elements drawn directly from his experiences during the war — for example, in the Second Eclogue, instead of staging a dialogue with a peasant, he speaks with a military pilot who conducts bombing raids by night: “Pilot: Went far out into the night; I laughed, I was so mad./Like swarms of bees the fighter planes buzzed overhead…” (Transl. Emory George, p.230).

Similarly in “Razglednica (2),” the war is invoked; the image of a flock of sheep which stoops to sip from a cloud-reflecting lake is framed by the five-mile-distant carnage of a village in flames. There is no significant narrative here; merely ironic juxtaposition of two images. I take pleasure in his description of the lake as if the sheep stoop to sip from a cloud, in his having taken note of this trompe l’oeil effect, presenting a verbal equivalent by means of metaphor. The invocation of the pastoral also invites us to consider the function of this lyric mode, and its very capacity to document or engage with the events of war, which it seems here to do most forcefully.

But I am still avoiding the issue of the formal qualities of the poem, as much as I can engage with them in a translation, not being able to read the original Hungarian. Radnóti often used classical and closed forms; the razglednici are written in quatrains, and employ cross rhyme; some of his translators attempt to offer similar formal patterns, while the Polgar, Berg, and Marks translation employs free verse. The decision to replicate the formal patterns is important, however, for his poems use these formal elements of poetry to stand against the chaos and unmaking of war. During the years of the war he made the deliberate choice of turning to classical structures, even though his earlier collections of poetry experimented with free verse; he seemed to have found strength in this formal patterning, so much so that he did not stop writing these poems, even under duress, as if the closed structures helped to order and contain the violence he witnessed.

Emery George’s 1980 translations of the entire corpus of Radnóti’s poetry attempt to preserve many of the formal qualities of Radnóti’s verse, as do the more recent translations by Zsuzsanna Ozsváth and Frederick Turner in their 1992 Foamy Sky: The Major Poems of Miklos Radnóti, and Francis R. Jones in Camp Notebook (2000). George notes he tries to follow Radnóti’s own translation principles:

“It would not do […] to render a hexameter work in ‘open’ form, any more than it would do to try to render it in Alexandrines or in blank verse. Every syllable contributes its share of the weight to careful work in meter or in the shaped line and stanza. Indeed fidelity requires that, wherever similarities in syntax permit it, even the relative positions of words be observed; that where lexicon and semantics favor it we show sensitivity to the possibility of sound repetition somewhere near the passage that exhibits it in the original […] In short, the translator of poetry had better have a good ear.” p.42]

He introduces all kinds of questions here regarding translation, but I want simply to note his insistence on the importance of form to Radnóti himself as translator and poet.

Here is George’s own translation of “Razglednica (2)”:

Nine kilometers from here the haystacks and
houses are burning;
sitting on the field’s edges, some scared and speechless
poor folk are smoking.
Here a little shepherdess, stepping onto the lake,
ruffles the water;
the ruffled sheep flock at the water drinks from
clouds, bending over.

The rhyme scheme, which both Jones and George preserve by means of slant rhyme is xaxa xbxb. Jones rhymes fire and fear, stride and cloud, while George strains towards burning/smoking, and water/over. Rhyme often reinforces semantic or emotional connections between words. In this, I find Jones’ translation more successful in the linking of fire to fear; the ambiguity of George’s poor folk ‘smoking,’ as if smouldering and not smoking a pipe, is unfortunate.

The two quatrains are used by Radnóti to set up two distinct images which contrast sharply and ironically with one another. In the first quatrain we see the distant, burning village and the peasant observers — and are perhaps reminded that we also watch, as from a great distance, this scene from almost seventy years ago. In the second quatrain a more typical pastoral image is presented of a shepherdess with her flock of sheep, which sip from the sky-reflecting lake. The ironic juxtaposition of the two images is strengthened by the formal elements of the first quatrain (alternating rhyme, line length) which are then mirrored in the second, as cloud is mirrored in lake, as the first image begins to obscure or cloud over the second as the war progresses.

George more successfully captures the rhythm of the original line, I suspect, with his use of a triple foot and falling rhythm. But I like the way in which Jones manages by means of enjambment to emphasize fire, silence, and fear in lines 2 and 4 of the first quatrain:

Five miles away the hayricks and houses
are going up in fire;
beside the fields, peasants smoke their pipes
in silence and in fear.

The first line with its reference to hayricks might be the opening of a simple pastoral quatrain, until the second line undercuts this with the words “are going up in fire.” Similarly, peasants smoking their pipes, another idyllic image, is quickly undercut by “in silence and in fear.” I don’t know if this effect is present in the original, but it is effective.

The very fact that Radnóti writes this poem while on a forced march, using elements such as metre and rhyme, quatrain form, image, metaphor, and the resultant compression of language this entails, can also be read as significant: he makes pattern out of a chaos of sound, a poem out of the chaos of war which, as Scarry observes in The Body in Pain, unmakes language along with many other human institutions. This tiny poem functions as counterforce to such destruction.

Similarly, I equally value in Radnóti’s poems from his Bor Notebook  the gesture of the individual voice, the single, quiet voice that speaks in the silence, in the dark.  As readers, we are allowed access to the imprint of his single consciousness — again an imprint that is found in the very formal qualities of the poem itself, a transcription of what this man thought as he rested in barracks (I don’t mean here a spontaneous trace of his conscious thought, but inevitably a re-presentation of this thought through formal means; Grossman–“Poems are fictions of the privacy of other minds. Wherever the philosopher says per impossibile the poet shows the way” p.147 Summa Lyrica), as in the magnificent “Seventh Eclogue” in which he describes a dream-journey from the forced labour camp back to his home:

from “Seventh Eclogue”

Look how evening descends and around us the barbed-wire-hemmed, wild
oaken fence and the barracks are weightless, as evening absorbs them.
Slowly the glance loses hold on the frame of our captive condition,
only the mind, it alone is alive to the tautness of wire.
See, Love: phantasy here, it too can attain to its freedom
only through dream, that comely redeemer who frees our broken
bodies — it’s time, and the men in the prison camp leave for their homes now.

(translation by Emery George, in The Complete Poetry)

Radnóti is using here the classical dactylic hexameter line, one which we are much less used to hearing in English, and which George attempts to reproduce — he speaks of Radnóti’s hexameter lines as having “grace, speed, and power” (p.42).

While Virgil uses hexameter lines to write the Eclogues, and this may be Radnóti’s more immediate model, we might consider also the use of the hexameter line as formal vehicle in epic poetry, foremost of which is the Iliad. In Susan Stewart’s Poetry and the Fate of the Senses (2002) she makes the useful distinction between the epic mode, which carries official ideologies, the state’s version of war, and the lyric mode, which, she argues, offers the perspective of the individual caught up in war, and carries traces of an individual’s sense-perceptions and emotions (p.296). Radnóti in his use of the hexameter line to write many of his last poems we might read as an undermining of this vehicle of official ideology; he uses it to convey the individual’s first-person experience of sensation and emotion, a private dream life in the midst of war. Frederick Turner in his translator’s essay in Foamy Sky, also notes the importance of this hexameter line in Radnóti’s poetry: “..the epic/pastoral hexameters of the first and eighth eclogues are fundamental to their meanings, recalling the power of Homer, the moral complexity of Virgil, and that strange Hadean combination of the arcadian and the heroic that we associate with the descent to the land of the dead” (p.xlvii).

Formal qualities are integral to the effect Radnóti seeks to achieve in these last poems. George acknowledges the documentary or trace aspect of Radnóti’s Bor poetry, and yet insists on their self-conscious attention to making:

“If ever there was art that moves beyond the naturalistically faithful documentation of life that it appears to be providing, it is the poems of the Bor Notebook. To be sure we have no reason not to accept at face value some of the conditions the poems depict, or — nearly so — some of the statements they represent a man as making. That the poet misses [his wife] Fanni and that he hopes to make superhuman attempts to return to her (“Seventh Eclogue,” “Letter to My Wife,” “Forced March”), that in the solitude of his brutish exile he is consoled by his thoughts (“Letter to My Wife,” “Eighth Eclogue”), that in the midst of his own predicament he is thinking of the many who have already met their fates in one form or another (“A la recherche….”) […] What may still need our attention is secrets of the poems not revealed by the images alone” (p.39).

George then goes on to note the deliberate invocation and undercutting of the pastoral, and the formal skill of the Bor poems, bearing “a hardness and diamond-like perfection” (p.40) In this, he is directing our attention to the formal over the documentary “trace” of this poetry.

Yet he also points out that the “Razglednica” as imitation “postcard” is part of a longer experimental tradition by Radnóti to engage with “letters, diary entries, newspaper reportage, expansions of poetic expression that parallel concrete and three-dimensional poetic happenings in our time” (p.40). Here Radnóti would seem to self-consciously engage with poem as documentary trace of an event.


[1] The Bor notebook comprised the 7th and 8th Eclogues, “Root,” “Letter to my Wife,” ” À la recherche,” “Forced March,” as well as the four Razglednici or postcard poems.

[2] Williams’ comment on Gubar and the role of narrative in poetry is not entirely fair. Consider her discussion of “Why poetry matters”  in chapter 1 of Poetry After Auschwitz: “poetry serves an important function here, for it abrogates narrative coherence and thereby sparks discontinuity […] In an effort to signal the impossibility of a sensible story, the poet provides spurts of vision, moments of truth, baffling but nevertheless powerful pictures of scenes unassimilated into an explanatory plot and thus seizes the past ‘as an image which flashes up at the instant when it can be recognized and is never seen again.’ According to Benjamin, images (not stories, which tend to recount the past so as to account for it) put the ‘then’ of the past into a dialectical relationship with the ‘now’ of the present, constitute a critique of the myth of progress, and promote mindfulness about how the past continues to exist as an outrage in the present.” p.7 That being said, however, I agree with him that in her actual treatment of individual poems, she glosses over more formally interesting poems by Celan, Forche, and others, concentrating largely on narrative-driven poetry, which she then herself critically narrates.

the DNA of Shakespeare’s Sonnets

January 25, 2013 § Leave a comment

“TAGATGTGTACAGACTACGC…..”   (Thou art more lovely and more temperate...)

An article in The Guardian today described DNA as a memory/archival system to store texts. The most recent experiment, by Nick Goldman and Ewan Birney of the European Bioinformatics Institute in Hinxton, tested DNA’s potential as an archival system by using it to store Shakespeare’s Sonnets, as well as an audio file of Martin Luther King Jr.’s 1963 “I have a dream” speech, and Francis Crick and James Watson’s paper describing the double helix of DNA. The texts were first translated into binary code, and then into the four “letters” or acids of DNA (CGAT). More on this below.

I’ve been thinking for a while now of poetry as the DNA of language, ever since I wrote a long sequence called “Karyotype.”  Initially I had only the idea of writing a poem about DNA, and a liking for the word ‘karyotype.’ In the end, I modelled my sequence on the 23 chromosomal complement of the human genome, writing each of the 23 poems in tercets, a gesture towards the three-letter codons or words that form our genetic code.

So how might poetry be the DNA of language? A poem carries the condensed storehouse of language and the knowledge that language holds; a poem inherits and recombines rhythms, cadences, words, sometimes whole lines, from other poems, from a body of world poetry, and carries this knowledge into the future. Each reading offers access to this knowledge, reembodies it, generates new meaning. Which brings me back to Shakespeare. Joyce comes in here, too, I think: both writers work at the very heart of this generative process, the scene of writing itself. But I don’t love Joyce as I do Shakespeare and the early modern period he was writing in—English itself at its embryonic—no, genetic—beginnings.

This leads me back to Sonnet 5 from my post on Dickinson. I like this sonnet, and disagree with Don Paterson’s dismissal of it as a “rather tedious poem” in his Reading Shakespeare’s Sonnets (a great book I’m reading during my office hour these days, trying not to laugh too loudly at his jokes so as not to disturb my neighbours).

Then were not summers distillation left
A liquid prisoner pent in walls of glasse,
Beauties effect with beauty were bereft,
Nor it nor noe remembrance what it was.

Shakespeare’s opening sonnets of course urge the Fair Youth to reproduce his beauty—his pattern; at first, he is encouraged to find a woman for this, else he “unblesse some mother” by not ploughing her “un-eard wombe” (Sonnet 3). That is, he is told to reproduce himself in the flesh; but then Shakespeare becomes proprietorial—he’ll reproduce and preserve the Fair Youth instead, in his verse (sonnet as womb? Shakespeare’s words as genetic code which combine/recombine with the Fair Youth?); his sonnets will preserve this pattern of beauty, a knowledge of the youth, even from beyond the grave.

The earliest forms of poetry also carried practical information—poems do things:  Hesiod’s Works and Days;  perhaps Virgil’s Georgics, but by then he’s after imitating the feel and style of Hesiod, and is maybe more show than substance. Beyond this more didactic understanding of a poem, which 21st century readers are turned off by, to call poetry the DNA of language is to think of poetry as the crucible where language is in the process of generating itself: so inevitably we always come back to those writers who seem to be at the very heart of this production/scene of writing/genetic workshop—Shakespeare, Joyce.

And now here’s this lovely twist: Shakespeare, who promised to preserve the Fair Youth’s pattern in the very genetic imprint of his sonnets, now has his sonnets translated into genetic code by Nick Goldman and Ewan Birney in order to demonstrate how we might preserve information, including the sonnets themselves, for the future.

The Guardian article explains how the encoding takes place:

“Digital files store data as strings of 1s and 0s. The Cambridge team’s code turns every block of eight numbers in a digital code into five letters of DNA. For example, the eight digit binary code for the letter “T” becomes TAGAT.

To store words, the scientists simply run the strands of five DNA letters together. So the first word in “Thou art more lovely and more temperate” from Shakespeare’s sonnet 18, becomes TAGATGTGTACAGACTACGC.”

This sounds like Shakespeare meets L=A=N=G=U=A=G=E poetry. Definitely something of the mellifluous original is lost in translation.

Then the DNA is stored in a dry, cool, dark place.

A few years ago I taught a course called “Writing the Human Genome,” which considered the metaphors being used today to describe the human genome: genome as alphabet, as language, as history of the human species that records our migrations, as scripture, as soul. Thinking of the genome as a book, we begin to apply the language of that register: editing, rewriting, drafts, writers, readers, with some fascinating, and disturbing, implications. How easily a single dropped letter authors disease and results in an individual’s cruel fate, so that we are tempted to think of the editing of “corrupt” genes/texts.

But these scientists were more interested in exploring DNA as archival system. There’s too much information in the world, and physical forms deteriorate.  Shakespeare knew this: “When fortie Winters shall beseige thy brow,/And digge deep trenches in thy beauties field…”  Books, digital and analogue storage devices, the need for more and more space, automatic retrieval systems; books are now housed at my university in a sort of High-Security Penitentiary for Books—if one gets misshelved  in those Area 51 metal boxes stacked to infinity, or is miscatalogued or its record erased, it will never be found again. So the idea of being able to store millions of books on slips of DNA— is tempting: go into a library and check out a blue vial of DNA you can slot into your reader. But of course with information storage technologies it always comes down in the end to readers.

In order to read Shakespeare’s Sonnets encoded on DNA, Nick Goldman and Ewan Birney took the encoded DNA and “mixed it into a solution and ran it through a gene sequencing machine. From that, they were able to read the complete files again.” Sometimes there are errors when DNA is copied; Goldman and Birney’s experiment has built-in redundancy—multiple copies of words are recorded so that such spelling errors can be caught (a genetic version of Shakespeare’s editors agonizing over variant quarto/folio editions). But you need to have the technology to ‘read’ the DNA, just as you need special readers to read digital and analogue files. So this DNA archival system will work as long as we have faith that the necessary technology will be around to read DNA, (or CDs, LPs, cassettes, 8-tracks) if or when civilization breaks down and then resurrects itself again….but here I’m getting apocalyptic. James Lovelock in the Revenge of Gaia insists on the importance of a simple but long-lasting technology: the book, as long as it is printed on durable, acid-free paper, with colour-fast inks, and lots of copies are made. Maybe some poems can survive too—some of them, passed on in an oral tradition. But I think printed books have a longer survival rate. The best readers are human.

Where Am I?

You are currently browsing entries tagged with Virgil at kim trainor's blog.